Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis  used to obtain DNA profiles, relying on sections of our DNA that are known as ‘junk DNA’.

We have many sections of ‘junk DNA’ on our chromosomes – DNA that does not seem to code for anything in particular. Within this ‘junk DNA’ are areas called short tandem repeats (STRs). As an example, you may have a stretch of DNA that is:

atcttctaacacatgaccgatcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgttccatgatagcacat

This sequence starts off looking random and then has repeats of the sequence catg in the middle and then becomes random again. The repetitive bit is what is referred to as an STR.

atcttctaacacatgaccgatcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgttccatgatagcacat

For a given STR you will have inherited different numbers of the repeated sequence from each of your parents. For example you may have inherited 11 repeats of the catg as shown above in sequence on a chromosome from your mother and 3 repeats of this sequence within the STR on the matching chromosome from your father. Because the number of repeats within an STR will create different lengths of DNA for that STR, electrophoresis can be used to show how many repeats you have in your STRs. These different lengths will show up in the results of electrophoresis and the banding pattern produced, called a DNA profile or fingerprint, can be analysed.

Usually, taking a DNA profile involves analysing your DNA for 10 different STRs on different chromo-somes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs. So your profile is unique.